Results of NSF Award
Biodiversity and Biogeochemistry of Antarctic Photosynthetic Bacteria
Michael T. Madigan and Laurie A. Achenbach
October 1, 1998-September 30, 2001

Summary of Results
Our results to date include the characterization of two extremophilic photosynthetic bacteria, one from an alkaline cool environment (Bryantseva et al., 1999) and one from an Antarctic microbial mat (Madigan et al., 2000). Field work on lakes in the Dry Valleys was done this past November and December. From this we have already obtained enrichment cultures of psychrophilic photosynthetic bacteria (see Section I and Section II below) and have done sufficient molecular analyses on microbial community DNA obtained from the water column of these lakes (see Section III and Section IV below) to know that: (1) several species of photosynthetic bacteria likely reside there (see Fig. 3), (2) Archaea as well as Bacteria are present (Fig. 4b), (3) sulfide is abundant in the Lake Fryxell water column, and (4) sulfur chemolithotrophs and sulfate-reducing bacteria are likely to be present. Molecular probes specific to purple phototrophic bacteria, green sulfur bacteria, green non-sulfur bacteria and heliobacteria were designed in the course of the project and have been successfully used to screen a variety of environmental samples for these types of photosynthetic bacteria (see Available Resources below).

I. A Purple Bacterium from an Antarctic Microbial Mat

A purple photosynthetic bacterium was isolated by the PIs from an Antarctic microbial mat (Madigan et al., 2000). The organism, Rhodoferax (Rfx.) antarcticus (Fig. 1) is the first psychrophilic anoxygenic phototroph known. Physiologically, Rfx. antarcticus grows optimally at 15°C (but not above 25°C) and is capable of both photoautotrophy (CO₂ + H₂) and nitrogen fixation (N₂ + 8 H ­> 2 NH₃ + H₂). Thus, from an ecological point of view, Rfx. antarcticus could be a primary producer and supplier of fixed nitrogen to other organisms in its microbial mat community. Moreover, laboratory cultures of Rfx antarcticus make available for the first time a model for the study of metabolic reactions in photosynthetic bacteria at low temperatures, and for exploring the architecture of pigment-protein complexes that function optimally in photosynthesis at low temperatures.

Fig. 1. Scanning electron micrograph of cells of Rhodoferax antarcticus. Average cell dimension is 0.7 ¥ 2-3 mm.

Fig. 2. Dot blot genomic DNA:DNA hybridization of digested DNA from A) Rfx. antarcticus, and B) Rfx. fermentans probed with digoxigenin-labeled genomic DNA from either 1) Rfx. antarcticus or 2) Rfx. fermentans.

Our results with Rfx. antarcticus also demonstrate another principle of importance to the proposed research: although Antarctic prokaryotes are often found to have close relatives that are mesophilic, their genes can be quite distinct from those of mesophiles and probably encode important biological solutions to life at cold temperature. For example, from a phylogenetic standpoint (comparative 16S rRNA sequencing) Rfx. antarcticus is closely related to the mesophile, Rfx. fermentans (Madigan et al., 2000). However, despite the fact that Rfx. antarcticus and Rfx. fermentans differ in 16S ribosomal RNA sequence by only about 2%, genomic DNA hybridization shows their genes to share essentially no sequence homology (Fig. 2). This is likely because as a psychrophile, Rfx. antarcticus must encode cold-active proteins and other macromolecules not required by Rfx. fermentans. From this result we predict that the sulfur-cycling and autotrophic Antarctic prokaryotes to be isolated in the proposed research will also contain novel genomes and that these new genetic resources will have a positive impact on our understanding of the biology and diversity of these organisms.

II. Purple Bacteria from Lake Fryxell

Samples of Lake Fryxell 9-12 m water filtered and subject to spectral analysis clearly showed the signature of phototrophic purple bacteria; absorption maxima were obtained at 800 and 850 nm, diagnostic for bacteriochlorophyll a (data not shown). And enrichment cultures (4°C) for purple bacteria from this and from benthic microbial mats in Lake Fryxell have already yielded two isolates, both of which are approaching axenic culture (Figs. 3a and 3c). The absorption maxima of cells enriched from Lake Fryxell water (Fig. 3b) are close to yet distinct from that of Lake Fryxell water per se, suggesting that other purple bacteria remain to be cultured; this conclusion is further supported by molecular evidence using DGGE (see Fig. 6). Further work with the Lake Fryxell isolate is in progress and its relatively rapid growth at 4°C suggests that it is well adapted to its frigid environment. Moreover, this organism likely contains gas vesicles (see arrows in phase photomicrograph of cells in Fig. 3a) and these may be critical for positioning the organism in the water column in order to obtain optimal light and/or sulfide levels for photosynthesis. A full characterization of these isolates is a key objective of the last year (October 00-September 01) of our current LExEn award.

(a) Phase photomicrograph of filamentous cells (arrows point to putative gas vesicles).	(b) in vivo absorption spectra from an enrichment culture for purple nonsulfur bacteria established using 10 m water.	(c) Phase photomicrograph of cells of a purple phototroph enriched from a microbial mat.

Fig. 3. Lake Fryxell anoxygenic phototrophs and pigments.

III. Molecular Probes Targeted to Anoxygenic Phototrophs

To facilitate the identification and isolation of psychrophilic photosynthetic bacteria from Antarctic lakes, we designed sets of PCR primers specific to either the 16S rDNA or the M subunit of the photosynthetic reaction center (encoded by the pufM gene) of several groups of photosynthetic bacteria. Three sets of 16S rDNA primers were specific to the heliobacteria (Gram-positive phylum), the green sulfur bacteria, and green nonsulfur bacteria. Positive and negative controls (pure cultures) were first tested and the primers were then used to screen environmental samples. Using the primers specific to the green sulfur bacteria for amplification and sequencing, we identified bacteria closely related to Chlorobium/Pelodictyon in a sample from Fletcher Lake, a hypersaline (10% NaCl) lake located in the Vestfold Hills of east Antarctica (68^o30'S) and from several other lakes in the vicinity. Cultures of green sulfur bacteria were then isolated and have undergone preliminary characterization (Jung et al., 2000). However, due to the phylogenetic diversity of purple sulfur and purple nonsulfur phototrophs, the 16S rRNA gene was not an appropriate target for these important phototrophs. Instead, we chose to focus on pufM, a gene that encodes the M subunit of the photosynthetic reaction center, universally distributed among purple phototrophic bacteria. Using an alignment of 29 pufM sequences, we designed two pufM primer sets that amplified DNA not only from all purple sulfur and purple nonsulfur phototrophs tested, but also from Chloroflexus species, which also produce a purple bacterial-type reaction center. And, although the purple bacterial reaction center structurally resembles green plant photosystem II, the pufM primers did not amplify cyanobacterial DNA, further indicating their specificity for purple anoxyphototrophs. Moreover, tests using pufM to amplify DNA from over 20 phylogenetically related but non-phototrophic Proteobacteria have been completely negative. This combination of phylogenetic and photosynthesis-specific probes thus covers all known groups of anoxygenic phototrophs, and as such can be used as a molecular tool for the rapid assessment of natural samples in ecological studies of these organisms. Using this suite of molecular probes for the profiling of phototrophic bacterial communities in Lakes Fryxell and Hoare, we detected the presence of photosynthetic purple bacteria but not green sulfur or green nonsulfur bacteria in both Lake Fryxell (Fig. 4a) and Lake Hoare (data not shown). In addition, we used universal archaeal primer sets targeted to 16S rDNA signature sequences to reveal the presence of Archaea in Lake Fryxell (Fig. 4b).

(a) Lanes (left to right) represent 6, 8, 9, 10 and 12 m water samples and marker.

(b) Lanes (left to right) represent marker, green mat, pink mat, red mat, and 9 m water.

Fig. 4: Amplifications from Lake Fryxell water and microbial mat samples using the (a) pufM and

(b) universal archaeal primer sets.

In the course of our work in the Antarctic, we also optimized procedures for the handling and storage of Antarctic lake samples destined for the extraction of genomic DNAs. Because of the relatively low biomass in Dry Valleys lakes, we concentrated cells by filtration onto sterile membranes. In duplicate samples, some of the filters were used immediately for DNA extraction and some were dried and stored for transport back to our lab in the U.S. For the extraction procedure, the filters were cut into small pieces using aseptic technique and the pieces placed in a capped tube with extraction buffer and zirconium beads. After processing the samples in a bead beater to lyse the cells adhering to the filter, total genomic DNA was extracted according to the BIO 101 FastDNA Soil Extraction Kit protocol. DNA yield from most samples was sufficient for visualization of a 2 µl sample on an agarose gel (Fig. 5). But in addition, the filters that were dried and transported back to the U.S. also yielded high-quality DNA after up to six weeks of storage at room temperature, demonstrating that sample processing and DNA extraction procedures can be separated by several weeks with no negative effects.

Fig. 5: Agarose gel of genomic DNA isolated from Lake Hoare water taken at different depths.

Lanes (left to right) represent gDNA isolated from water samples taken from 4, 6, 8, 10, 12, 14, 16, 18,

and 19 m depths. Note the decreasing amounts of recovered DNA with increasing depth.

IV. Community Profiling of Anoxygenic Photosynthetic Bacteria

Community sampling of anoxygenic phototrophs from Antarctic lakes is currently underway using samples (both mat and water) collected during our 1999 expedition. Profile analysis was performed on mat samples from Lake Fryxell using denaturing gradient gel electrophoresis (DGGE). The mat samples were collected from the moat area around Lake Fryxell that forms during the austral summer thaw. Genomic DNA was extracted and probed for green sulfur, green nonsulfur, and photosynthetic purple bacteria. Only the latter was positive in PCR reactions. The amplification products from a reaction using the pufM primer set specific for photosynthetic purple bacteria were electrophoresed on a DGGE gel, stained and photographed (Fig. 6). The number of distinct phylotypes (bands on the DGGE gel) observed varied from four to seven per sample (Fig. 6). Three phylotypes were present in all four mat samples (Fig. 6) and we are now in the process of cloning and sequencing these amplification products. We are also currently performing DGGE analysis on the amplification products from photosynthetic purple bacteria (using the pufM primer set) in water column samples from Lakes Fryxell and Hoare.

.
Fig. 6: DGGE gel of pufM amplification products from

samples of four different microbial mats from Lake Fryxell.

Publications supported by OPP9809165:

1. Madigan, M.T. 1998. Isolation and characterization of psychrophilic purple bacteria from Antarctica, pg. 699-706. In: Peschek, G.A., W. Löffelhardt and G. Schmetterer (eds.), The Phototrophic Prokaryotes. Plenum Press, New York.

2. Madigan, M.T. and A. Oren. 1999. Thermophilic and halophilic extremophiles. Curr. Op. Microbiol. 2: 265-269.

3. Bryantseva, I.A., V.M. Gorlenko, E.I. Kompantseva, L.A. Achenbach, and M.T. Madigan. 1999. Heliorestis daurensis gen. nov. sp. nov., an alkaliphilic coiled to rod-shaped phototrophic heliobacterium from an alkaline Siberian soda lake. Arch. Microbiol. 172: 167-174.

4. Madigan, M.T., D.O. Jung, C.R. Woese and L.A. Achenbach. 2000. Rhodoferax antarcticus, sp. nov. a moderately psychrophilic purple nonsulfur bacterium from an Antarctic microbial mat. Arch. Microbiol. 173: 269-277.

Available resources: Cultures of Heliorestis daurensis (ATCC 700798) or Rhodoferax antarcticus (ATCC 700587) are available from the PIs or from the American Type Culture Collection (ATCC). Ribosomal RNA sequences for these organisms have been deposited in Genbank.

Primer sequences for primers specific to groups of anoxygenic photosynthetic bacteria are as follows:

Oligo Name	Sequence (5' > 3')	Bacterial Groups
pufM.557F	CGCACCTGGACTGGAC	Purple bacteria
pufM.557FA	CSCACCTCGACTGGAC	Purple bacteria
pufM.750R	CCCATGGTCCAGCGCCAGAA	Purple bacteria
GS.619F	GGGGTTAAATCCATGTGCT	Green sulfur
GS.1144R	CAGTTCARTTAGAGTCC	Green sulfur
GNS.856F	TGCCTTAGCTCACGCGGTAA	Green non-sulfur
GNS.1240R	GCAACGCATTGTCGTGGCCA	Green non-sulfur
Helio.418F	TCTTCGGATTGTAAACCC	Heliobacteria
Helio.1159R	CCGGTCCCGGGCA	Heliobacteria

Any opinions, findings, and conclusions or recommendations
expressed in this material are those of the author(s) and do not
necessarily reflect the views of the National Science Foundation

To top of page

Back to Antarctic Home Page

SIUC / College of Science / Microbiology
URL: http://www.micro.siu.edu/Antarctica/Research.html
Last updated: 26-Jun-00 / laa